helpme3730 helpme3730

02-04-2019
Biology

contestada

This food chain can be found in the coastal waters of Virginia

Respuesta :

aizleebeecham64 aizleebeecham64

02-04-2019

hope this helps mannnnnnnnnnnnnnnnnnnnnn

Ver imagen aizleebeecham64

Answer Link

Аноним Аноним

02-04-2019

DAMEFISH would be your correct answer

Answer Link

Otras preguntas

6. Which of the following is a consequence of chronic alcohol use? A. gastritis B. stomach ulcers C. heartburn D. All of the above

Which country use tax brackets as part of their tax system? canada australia south africa all of the above?

A collection of dimes and quarters is worth 15.25. there are 103 coins in all. how many of each are there

The area of a rectangle is 55 m^2 , and the length of the rectangle is 4 m less than three times the width. Find the dimensions of the rectangle.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

an equilateral triangle has perimeter 18 inches. what would be the perimeter of a square whose sides each measure the same length as the side of the triangle?

x 2 • x 5 answer quick

The available farmland in Mali is in the northeast. True or false

Phillip advised his clients they needed to paint their master bedroom before showing the property. the walls of this room were 11' high. the wall lengths were 1

Why would a signature item, such as distinctive button or tag, be considered a need even if it was not essential to the item’s function? -f someone powerful in