jadahilbun01
jadahilbun01 jadahilbun01
  • 04-04-2019
  • English
contestada

Not sure if that’s the right answer, help?

Not sure if thats the right answer help class=

Respuesta :

camposlinares camposlinares
  • 04-04-2019

you opition would the answer  is B

Answer Link
TheBeef
TheBeef TheBeef
  • 04-04-2019

The speaker is using a somewhat melancholy tone. Speaking about how Len sees the "brighter side of things", which is a sign of optimism. In short, yes. You are correct.

Answer Link

Otras preguntas

How has water influenced the development of civilization in Africa
A generator stores electric current. Explain why you agree or disagree with this statement
Failure to incorporate _______ can easily lead to _______. Would the answer be: citations, plagiarism?
the bombing of Hiroshima and Nagasaki resulted in
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
What statement best describes a republic?
In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5