zakoplayzz zakoplayzz

03-02-2020
English

contestada

Which sentence is NOT written in passive voice?

Respuesta :

05-02-2020

Answer: an example of passive voice would be A camera is brought with him, In Active voice it would be He buys a camera

Explanation:

Answer Link

Otras preguntas

5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20

An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.

Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.

the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.

Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?

Solve the equation -10 + 3x + 5x = -56 ? ??

Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage

A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile