laanjuCleli6a
laanjuCleli6a laanjuCleli6a
  • 04-08-2016
  • Chemistry
contestada

Which is better solvent: water or carbon tetrachloride?

Respuesta :

taskmasters
taskmasters taskmasters
  • 06-08-2016
To know which is a better solvent between the two, one should know what will be the solute. It really depends on what type of solute you have. If the solute is polar then water is the better solvent for that type of solute. However, when the solute is a nonpolar substance then carbon tetrachloride is the better solvent.
Answer Link

Otras preguntas

what was NOT a primary goal of marriage in a feudal system at the noble level? A. Exchange of land and goods B. love and companionship C. Political arrangement
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
31+34=90-n 45+1=70-k 6×9=41+m
why did russia have revolution in 1917?
Do all your pet's offspring look the same? If no, then explain why they look different.
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Where did middle names come from
Which of the following was not an accomplishment of the emperor Trajanlegalized Christianity       built bridges, aqueducts and harbors       reduced taxes
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?