thatlilpanda24 thatlilpanda24

02-06-2020
Health

contestada

How does your respiratory system supply oxygen and remove wastes from cells?

Respuesta :

Аноним Аноним

02-06-2020

Answer:

Oxygen passes from inside the alveoli through the thin walls and dif- fuses into the blood. At the same time, carbon dioxide waste passes from the blood into the alveoli.

Explanation:

Answer Link

Otras preguntas

describe five ways to set strategy for effectively gathering patients information

The word biology means the study of _____. plants animals organisms life

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

El clima de la costa Guatemalteca es tropical, es decir es ______________________.

how did white supremacists provide support for the ku klux klan

A sample of gas at 25ºc has a volume of 11 l and exerts a pressure of 660 mm hg. how many moles of gas are in the sample?

Which factor played a role in the sudden drop after 1928? A. Lack of demand B. Lack of supply C. Lack of credit D. Lack of income

Which one of the following will likely be revealed in the inspection report? A. school attendance zone B. termite damage C. age of the property D. liens

If an employee gets potentially infectious material splashed in his eye, what should he do?

Does the increase in blood glucose levels increase the viscosity of the blood