gshreya2005
gshreya2005 gshreya2005
  • 02-09-2020
  • Mathematics
contestada

pls help i will mark brainliest......i have a time limit

pls help i will mark brainliesti have a time limit class=
pls help i will mark brainliesti have a time limit class=

Respuesta :

Аноним Аноним
  • 02-09-2020

Answer:

Hey there!

If angle one is congruent to angle two, all of the above is true.

Let me know if this helps :)

Answer Link

Otras preguntas

Hallucinogens can cause __________. A. extremely high speed B. slowing down or stopping in the middle of a freeway C. heightened focus on the driving task D. A
^5sqrt4x^2 ^5sqrt4^2
from what you have heard about modern war
How many significant figures are there is the numerical value: 0.00019?
235u92 and 238u92 are examples of _____. select one: a. particles of radiation b. allotropes c. tracers d. isotopes
great Britain is an example of a core nation True or False
The octet rule states that, in chemical compounds, atoms tend to have ____. the electron configuration of a noble gas more protons than electrons eight electron
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What did president wilson's wife make sure was on the white house lawn?
How to find the length of a triangle with only one side non right triangle?