JaciePettigrew JaciePettigrew
  • 03-11-2020
  • Mathematics
contestada

Please help!!! (5 points)

Please help 5 points class=

Respuesta :

shyannemurphy1237 shyannemurphy1237
  • 03-11-2020

Answer:

0.75

Step-by-step explanation:

Answer Link

Otras preguntas

Help plsssssssssssss
How did world war i and the treaty of versailles contribute to the rise of fascism in the 1920s and 30s?
. Find the approximate length of the hypotenuse of a right triangle with leg lengths 8.4 cm and 7.6 cm. 4.00 cm 7.99 cm 5.66 cm 11.33 cm
The culture of children strongly approves of children tattling on one and other. a. True b. False
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
A school bus has 22 rows of seats, and 4 students can be seated in each row. students have filled 19 rows of seats, abd 1/2 of the remaining seats. how many sea
True or false? physical factors affecting community health include geography, community size, and industrial development.
Find the length of the missing side of a right triangle if a=6 and c=11
What does the word "Islam" mean?
The vessels that are responsible for carrying blood away from the heart are