darksamanda darksamanda

01-03-2021
Chemistry

contestada

How many significant figures are in the number 020.310

Respuesta :

01-03-2021

Answer:

5

Explanation:

Sorry, don't have one

Hope this helps and I get brainliest <3

Answer Link

Otras preguntas

2. You must use headlights when driving ___________________. A. between sunset and sunrise B. in rain C. half hour after sunset and half hour before sunrise D.

help quick please!! Thanks

PLEASE I BEG YOU, HELP ME!!!!!!!! Find the rate of change of the function h(x) = 2^x on the interval 2 ≤ x ≤ 4. The rate of change is what?

how much longer is a 1-inch button than a 3/8-inch button?how much longer is a 1-inch button then a 3/8

The moon can always be seen from every part of the earth. This is a(n) ____________statement. a. Qualified c. Neither of these b. Absolute d. Both of these

How are logos, pathos, and ethos I used in an argument

The _______ was Franklin Roosevelt's program designed to fight the Great Depression

Which individual is correctly paired with the historical event he helped influence?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which factor controls the water cycle? A. Energy from the sun B. Changing ocean currents C. Volcanic eruptions D. Burning of fossil fuels