video4all video4all
  • 04-03-2021
  • Biology
contestada

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Respuesta :

addysenseheult addysenseheult
  • 04-03-2021

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

Answer Link

Otras preguntas

explain the significance of laissez-fair,market structure, perfect competition,imperfect competition,monopolistic competition, product differentiation,nonprice
What is 2 3/8 simplified?
Help! x=2/3+4•9 PLEASE HELP
Frank is on the swim team. each day he swims 850m . how many kilometers does he swim each day?
Aluminum has a density of 2.70 g/mL. Calculate the mass (in grams) of a piece of aluminum having a volume of 239 mL .
What is the gcf of 21 30 and 44what is the gcf of 21 , 30 , and 44?
The antibodies that attack antigens on foreign rbcs are called __________.
-2[4-(3b+2)]=5-2(3b+6)
Witch is greater 100in or 3yd 1ft
After serving as the commander of us forces in europe, dwight d. eisenhower a became the supreme commander of the allied expeditionary force. b served in the p