pariso82 pariso82
  • 03-05-2021
  • Biology
contestada

Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
T-A-C-G-T-C-A-G-T-G-G|
2. You just wrote in the template strand of DNA. Use the template strand to transcribe a strand
of mRNA
mRNA

Respuesta :

clarareina04 clarareina04
  • 03-05-2021

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

Answer Link

Otras preguntas

how much sperm does it take to make a baby?
Which sign is the less sign and which one is the greater sign (can someone please tell me I really need help! and I never understand the signs!) is this greater
When 70,000 is written as 7.0 10^{n} what is the value of n ? Can you please explain with some details?
What are the positive and negative aspects of a zoo or safari park?
Indicate which pattern of evolution is shown by the many species of finches on the Galápagos Islands.
How many months is 0.75 of a year
Identify the like terms. 9x, 10y, –9y,  10   A. 9x and 10
Rmshot bought a 3.5oz chocolate bar.within 15minutes he had eaten 0.6 of the bar. How many ounces did he eat?
What is the simplified form of the expression 2 * [(1+14)*7]+6/0.5^3?
What does el muslo mean?