zjohnson9350
zjohnson9350 zjohnson9350
  • 04-05-2021
  • Mathematics
contestada

Find the surface area of this cube

Find the surface area of this cube class=

Respuesta :

zedzeroknight zedzeroknight
  • 04-05-2021

Answer:

512 in^3

Step-by-step explanation:

It would be length x height x width = AREA

8 x 8 x 8= 512 and since its 3d it will be 512^3

Answer Link
jazieltheb
jazieltheb jazieltheb
  • 04-05-2021
Okay so I will not be doing an explanation cause I do them to long so I will just give you the answer 512^2 in.Hope this helps :)
Answer Link

Otras preguntas

How did the Hellenistic kings spread Greek culture
Find the measure of an exterior angle of each regular polygon: 100-gon.
What is the value of x?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
I know you would not mind if we could fight and wrest the scepter from your hands. you know that we are powerless to do that, for you have ensured our incapacit
If your company has a large production-related task, such as assembling an airplane, what strategy could help you increase productivity?
You develop an app to help students complete their homework. To earn money, you sell advertising space on the app’s main screen. An advertiser pays you $25 per
A rectangular garden hasblengtg and width as given by thr expression below length 4-7(3x+4y) eifth 3x(-2y) write a simplifird expression for the perimeter of th
Application of force with movement is called _______________ exercise.
What does the word "Islam" mean?