cgonzalez0466 cgonzalez0466

03-07-2021
History

contestada

The father in an ancient Roman family was legally allowed to

Respuesta :

glendahernandezmont glendahernandezmont

07-07-2021

Answer:

They had absolute rule over his household and children. If they angered him, he had the legal right to disown his children, sell them into slavery or even kill them.

Explanation:

Answer Link

Otras preguntas

Dr. shiguli wants to determine the lightest touch that can be felt by various animals compared to human beings. he would therefore be interested in finding the

a chef uses 4 3/4 cups of broth for 10 servings of soup. How much broth is used in one serving of soup?

Everyone in the neighborhood has been complaining about the deteriorating condition of the park, but nobody has cleaned it up. why not

PLEASE HELP!!!! Only 8 of those will match up

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Mrs. smith underwent an arthrodesis of her spine for spinal deformity, posterior approach, segments l3-l5. what procedure code is reported

The "aha!" moment demonstrated by wolfgang kohler's work with chimpanzees demonstrates:

An element's atomic number is 64. How many protons would an atom of this element have?

Renaissance painters in flanders as in italy tended to produce work that was

PLEASE HELP ASAP what is the correct product of (7x - 3)(7x + 3).49x^2 + 949x^2 - 42x + 9 49x^2 - 949x^2 + 42x + 9