mia1822
mia1822 mia1822
  • 02-12-2021
  • Mathematics
contestada

25) 2x + 3y = 9
find slope and y intercept

Respuesta :

DumxbPerson DumxbPerson
  • 02-12-2021

Answer: Slope = -2/3      Y-intercept = (0,3)

Step-by-step explanation: Use the slope-intercept form y = mx + b to find the slope m and y-intercept b.

Answer Link

Otras preguntas

an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.
How do I do trebuchet calculations????? Help me please
What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
A vehicle is only 15% efficient. What happened to the other 85%?