phiferisrael9 phiferisrael9

01-03-2022
Mathematics

contestada

in Indiana the sales tax rate is 7% of the total cost. what is the amount of sales tax on a purchase of 47$

Respuesta :

jdoe0001 jdoe0001

01-03-2022

[tex]\begin{array}{|c|ll} \cline{1-1} \textit{a\% of b}\\ \cline{1-1} \\ \left( \cfrac{a}{100} \right)\cdot b \\\\ \cline{1-1} \end{array}~\hspace{5em}\stackrel{\textit{7\% of 47}}{\left( \cfrac{7}{100} \right)47}\implies 3.29[/tex]

Answer Link

Otras preguntas

How to find the length of a triangle with only one side non right triangle?

1 pts. what is one difference between primary and secondary succession? a. primary succession is rapid and secondary succession is slow. b. secondary succession

(-5x^2)^3 plzzzz help

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Part 1: find the slope of the line that passes through the points (2, 1) and (2, 0). part 2: in two or more complete sentences, explain why it is not possible t

Where did the majority of people t ravel from who were heading to make a new life out of the west?

what is x? using the picture below and directions

In a survey, a group of students were asked to name their favorite day of the week. There were 8 students who chose “other”. How many students participated? Sa

Which graph is a translation of f(x)=x^2, according to the rule: y=(x-2)^2

Quinn is determining the area of a trapezoid. His work is shown below. mc012-1.jpg Step 1: Break the figure into rectangles and triangles. mc012-2.jpg Step