velezlsl velezlsl

03-09-2022
Mathematics

contestada

() Which number is closest to √5?
1.7
2.2
3.4
3.1

Respuesta :

ANCKPOP ANCKPOP

03-09-2022

Answer:

Step-by-step explanation:

Ver imagen ANCKPOP

Answer Link

Otras preguntas

PLEASE HELP ASAP find the quotient of -12x^3 + 21x^2 - 6x/ -3x.-4x^2 - 7x + 184x^2 + 7x + 18-12x^3 + 21x^2 + 24x^2 - 7x + 2

why are the hindlimbs important on the frog

__________ is widely considered to be the founder of the professional american police department.

The "aha!" moment demonstrated by wolfgang kohler's work with chimpanzees demonstrates:

Describe the set of data {33, 35, 38, 44, 45, 45, 46, 46, 46, 47}. a. normal distribution c. cannot be determined b. negatively skewed d. positively skewed

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

A new predator is introduced into the ecosystem shown in the food web below. This predator feeds on bees and mice. How will this most likely affect the specie

Name the five transport mechanisms of the cell:

you rent a well-lit flat in philidelpia for $1,080 per month. your landlord, knowing that new apatments are being built nearby, decreases you rent by 3%each yea

*The sum of two numbers is 400. If the first number is decreased by 20% and the second number is decreased by 15%, then the sum would be 68 less. Find the numbe