chelseaguerrero chelseaguerrero

01-06-2017
Social Studies

contestada

Which natural resource is found in the Sahara ?

Respuesta :

countryhuntingal countryhuntingal

01-06-2017

Minerals, rich phosphate deposits, fuel resorces include, coal, oil, and natural gas.

Answer Link

Otras preguntas

Which number sentence is true?OA) |-60 < 6OB) |-12< 12OC) |-6] < |-121D) 6| > |-121

Listed below are amounts (in millions of dollars) collected from parking meters by a security service company and other companies during similar time periods. D

Help me please and give me easy way how to solve

4 g = 16 g= please solve

What is the slope of the line shown below?10(5, 11)O A.5B.ס |U1015*(-5, -1)-5HHHHHHOC.OD.-10SUBMIT

It takes 3 1/3 spoons of chocolate syrup to make 3 1/2 į gallons of chocolate milk.How many spoons of syrup would it take to make 5 gallons of chocolate milk?

mochi the panda cub has been measured and weighed each week since she was born.weeks. weigh0. 11. 52. 93. 13mochi's brother is kappa.his weight has been charted

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

Parts of macromolecules that cause the specific immune response are called:A. antibodies B. prostaglandins C. plasma proteinsD. antigens

i need help trying to write a system of linear equations for the graph below