johns7163 johns7163
  • 01-07-2017
  • Arts
contestada

What style of poetry is whitman known for writing?

Respuesta :

JAZZ1161 JAZZ1161
  • 05-07-2017
he writes different styles of poetry but is most known for his spoken word
Answer Link

Otras preguntas

Which of the following best describes how Esperanza and her friends 'try on a different reality' in their neighborhood? A. They talk to the girls in the neigh
What has enfield learned about the run down labratory
What is the range for this set of data? 7, 15, 12
After a recent experiment, a meteorologist noticed that the computer simulation varied from the actual experiment. What should the meteorologist do? a: Repeat t
Accounts receivable turnover and days’ sales in receivables For two recent years, Robinhood Company reported the following: 20Y9 20Y8 Sales $7,906,000 $6,726,00
1. Why does McIntosh start her essay by saying "I was taught to see racism only in individual acts of meanness, not in invisible systems conferring dominance on
Write a do-while loop that continues to prompt a user to enter a number less than 100, until the entered number is actually less than 100. End each prompt with
Now you will write the opening paragraph of your letter. Your opening should greet the reader, appeal to the emotion you want the reader to feel, and explain w
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
The sum of two numbers is 54. One number is 26 more than the other. Find the numbers.