kikiladyj3953 kikiladyj3953
  • 01-09-2017
  • Chemistry
contestada

Chlorine has the electron configuration 1s22s22p63s23p5. how many valence electrons does it have?

Respuesta :

Palmetto18
Palmetto18 Palmetto18
  • 09-09-2017
7 because the third energy level​ isn't filled so 3s2 and 3p5 are valence.
Answer Link

Otras preguntas

On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
an explanation describe if a square-eyed pet mates with another square-eyed pet, can they have any round-eyed offspring.
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
p(x) x^3+x^2-x-1 Find all zeros of p (x)
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
Why did the American public mostly oppose joining the League of Nations after WWI?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile