barbaraelmy11 barbaraelmy11
  • 02-11-2017
  • Mathematics
contestada

When you divide a whole number by a decimal less than 1, the quotient is greater than the whole number. Why?

Respuesta :

dumdumy33
dumdumy33 dumdumy33
  • 02-11-2017
For this type of problem you would have to move the decimal as many places to the right as needed to make the divisor a whole number the you would move the dividend the same amount of times even if it is a whole number . Then you use what you have to divide normally. Hope this helps!
Answer Link

Otras preguntas

3+1/4x greater than 11
if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
What is the difference between "Herr" and "Herrn"?
What were the driving forces behind the industrial revolution
Explain who or what "Año Viejo" is and its significance.
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
if a star is shown ti be 33.11 trillion killometers away , how many light year would that be