Xoxoangie Xoxoangie
  • 02-12-2017
  • Mathematics
contestada

Express the fractions 1/2, 3/16, and 7/8 with an LCD

Respuesta :

lesliekolleroxrkcf
lesliekolleroxrkcf lesliekolleroxrkcf
  • 02-12-2017
8/16. 3/16. 14/16........
Answer Link

Otras preguntas

What does hemostasis mean?
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
does a human body use neon???
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
In which system of government would states function independently of each other?
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4